backtop


Print 101 comment(s) - last by FaceMaster.. on Feb 9 at 3:41 PM


Scientists have cloned a Pyrenean ibex, an extinct genetically distinct subspecies of the Spanish ibex, shown here. The ibex, known for its curved horns went extinct in 2000. Scientists resurrected it with a skin sample, though it was born with a lung defect and soon died.  (Source: Jose Luis GOMEZ de FRANCISCO/naturepl.com)
New cloning work could clear the way for resurrection of many recently extinct beasts

In the realm of commercial cloning, trickled-down technology from this cutting edge field of research has allowed firms to offer pet cloning services.  And in the realm of research, tremendous advances continue as scientists are hatching plans to resurrect extinct beasts.  Scientists have almost finished mapping the Woolly Mammoth genome, and have already injected DNA from an extinct species into a mouse.

Now arguably the greatest landmark event for the field of cloning has occurred.  Scientists have for the first time cloned an extinct animal, the Pyrenean ibex, a form of wild mountain goat.  The really spectacular thing about this cloning effort is that it was done using only DNA from skin samples. 

Technically classed as a genetically distinct subspecies of the Spanish ibex, the Pyrenean ibex, or bucardo as it is called by the locals, used to roam the mountainous hillside of northern Spain.  Known for its distinct horns, the animal was a popular target for hunters, and by the 19th century only 100 were left.  The species was not declared protected until 1973, at which time there were around 30 animals.  In 2000, the last known member of this critically endangered species was found dead on a hillside.  Researchers at the time decided to wisely preserve skin samples in liquid nitrogen.

The well-preserved skin samples proved a fruitful source for DNA.  Replicating this DNA using common genomic techniques, the researchers injected it into goat eggs, replacing the goat DNA.

While a great success, the effort also showcased the difficult road ahead for producing viable clones.  While born alive, the newborn ibex kid had defects in its lungs, similar to those found in many cloned sheep, and they proved fatal.  However, as some sheep clones have lived relatively normal lifespans, the success raises the hope of a more permanent resurrection.

Dr Jose Folch, from the Centre of Food Technology and Research of Aragon helped lead the research.  He states, "The delivered kid was genetically identical to the bucardo. In species such as bucardo, cloning is the only possibility to avoid its complete disappearance."

Professor Robert Miller, director the Medical Research Council's Reproductive Sciences Unit at Edinburgh University who heads a northern white rhino cloning effort funded by the Royal Zoological Society of Scotland cheered the news.  He states, "I think this is an exciting advance as it does show the potential of being able to regenerate extinct species. Clearly there is some way to go before it can be used effectively, but the advances in this field are such that we will see more and more solutions to the problems faced."

The race is now on to make sure that critically endangered species' tissues are preserved for future cloning efforts.  Britain's Zoological Society of London and America's Natural History Museum have teamed up in a project called Frozen Ark.  They are in the process of storing samples from thousands of species.

While cloning a dinosaur is highly improbable due to DNA's chemical tendency to rapidly break apart to the point where it cannot be sequenced, this new breakthrough paves the way for cloning of both endangered species, and extinct species with fully sequenced genomes, such as Neanderthals or, likely soon, the Woolly Mammoth.  However, this new work also highlights the extreme challenge ahead in trying to establish a sustainable population of a cloned animal, or even clones that live to reach adulthood.



Comments     Threshold


This article is over a month old, voting and posting comments is disabled

No Jurassic Park
By Chemical Chris on 2/2/2009 12:39:57 PM , Rating: 3
quote:
While cloning a dinosaur is highly improbable due to DNA's chemical tendency to rapidly break apart to the point where it cannot be sequenced

This is half-correct. Dinosaur's will never, ever, ever be cloned. The bones arent 'bones', they are essentially rocks. There is no trace of DNA. However, they have found 'fossils' where the DNA is visible, or rather, the imprint of where the DNA was is visible. But there is no DNA, and the fine detail needed to extract which base was in each position is long gone. So, anything that's been extinct for a few million years is never going to come back. Its one of lifes little unsolvable mysteries.
On the other hand, cloning long-dead animals may prove possible. In an average cell, there are ~10000 depurinations/24hr, a result of thermodynamics/equilibrium (purines are the A and G bases, pyrimidines are the C, U, and T bases). Normally, the cells DNA repair machinery repairs these errors. Once you die, this stops, and errors accumulate. Please note that the rate of depurination is not constant, the rate of loss decreases with time....think of it like half life of a radioactive element.
So, while there are some samples of Mammoth DNA, it is quite hard to get a viable sequence out of it, due to the loss of so many bases. One DNA sample will never be enough to get a working copy.
However, all is not lost. Some techniques I'm learning (Ive almost completed by Bachelors in Biochem, planning on a Masters) include sequencing what you have, from many seperate sources, and then using a computer to figure out which sequences overlap, and using hte information from the two incomplete sequences to generate a more complete sequence. IE:
____ATACGCATA___AGATAC_____AGTCG +
ATGC___CGA__ACTGAGA__CAGATAAG___ =
ATGCATACGAATACTGAGATACAGATAAGTCG
So while each piece by itself is essnetially useless, by sequencing as much as possible, and using a computer to figure out how it bests fits together, a viable sequence can be obtained (IIRC this is called Shotgun Sequencing, and is pretty quick, cheap, and effective, thanks to powerful computers). Computer power required is immense: A human genome has ~40 Billion base pairs....so there is a lot of math and memory required)
But, just shotgun sequencing isnt really enough for badly degraded DNA, like the mammoth. So, we need more tools. Enter comparative genomics; we take a closely related set of animals (an elephant), and compare the DNA which is missing data from the mammoth, with homologous (similiar) sequences in the elephant. You may have heard how we share 99.7% of our DNA with chimps; much of the DNA is conserved, only slight differences account for the different morphologies. So, an enzyme in a mammoth that converts A to B, and is also present in elephant, will likely be very similiar. So, you compare the two (as in the previous DNA comparison example), and use the living species to 'fill in the blanks' of the ancient species. The mammoth DNA takes precedence, if available. While comparing to an elephant may introduce some mistakes, these are often inconsequential. Of course, they're often show-stoppers to.
So, even if we cant figure out a complete sequence from many partial mammoth sequences, we should be able to fill in the blanks with elephants, and clone a mammoth.

In conclusion, cloning a wooly mammoth is possible, and will likely be completed relatively soon. Which is cool. But dinosaurs, or anything which we do not have organic remains of, will never be cloned. Never ever ever. Which is sad. But, C'est la vie!

ChemC




RE: No Jurassic Park
By Larrymon2000 on 2/2/2009 1:15:18 PM , Rating: 2
Well they thought of this in Jurassic Park as well. it's not as if they found some fossils and ran it through the clon-o-tron. They found preserved blood inside a mosquito solidified in amber. Of course, this is a FAR stretch as there's no guarantee you'd ever even be able to find mosquitos trapped in amber, much less mosquitos with SO many species of blood!


RE: No Jurassic Park
By Chemical Chris on 2/2/2009 3:12:05 PM , Rating: 4
Sorry, but Im afraid you don't fully understand thermodynamics. Im not being condescending, its a very geeky pursuit, and very, very few people *fully* understand....there's lots of math based on greek symbols, so the expression "It all looks Greek to me" is quite apt, lol ;)
5652182
But anyway, at the atomic scale, electrons and photons are flying around at nearly the speed of light, and all the atoms are vibrating, jostling, bumping into each other, inter-atom bonds are vibrating, stretching and compressing, bending, electrons are flying around conjugated systems, and so on.
But I digress. In order for a reaction to occur, the reactants must be in exactly the right orientation, with their electronic configuration exactly as it needs to be, then a reaction occurs. Its all about probability. The probability is generally quite low, but since billions upon billions of them happen every second, eventually, it happens. The only way it doesnt happen is if the system has 0 energy: that is, its temperature is absolute zero (~ -273C), and all subatomic movement has ceased....this is currently theorized to be impossible. Otherwise, its just a matter of time.
In fact, even in minerals (stuff that is a solid crystalline lattice), where all the atoms are nicely organized in exactly the same way throughout the lattice, bonds are being broken and reformed all the time. But since when a bond breaks, the probability of an adjacent bond breaking, and having the suitable conditions to create a different/new bond, is quite low. So, the bond breaks, then re-bonds the same one that was broken.
In organic material, there is no crystalline lattice, things (chunks) are floating around in what is essentially a thick soup....mmmm chunky soup :) There are also many reactive species, like carbonyl compounds, nitrogen species, and so on. So, over time, it will just become a pile of oil, then rock.
And there is No Way you would be able to find the conditions naturally for such a complex single chemical molecule (DNA) to last >60million years. Even artificially, it would be tough.
And besides, amber didnt start as amber, did it? It was a mix of complex and simple organic compounds from trees, which had the unlikely probability of appropriate conditions for amber to form (but some always does!). All those organic molecules, over time, interacted to form the more stable things (many factors affect the most stable configuration.....complex ones arent stable, such as DNA). So, now the amber is made up of all kinds of cool compounds, which look very little like the original. Any live bug trapped inside would undergo similar changes, and would likely have a 'rocky' composition. You might even be able to make out the outline of where DNA fibers were, but rest assured, there is no fine detail. But we have been able to see how many chromosomes some species had, which is quite interesting to evolutionary biologists anyhow.

Short Version: The disorder of the system will always increase.

ChemC


RE: No Jurassic Park
By Chemical Chris on 2/2/2009 3:13:31 PM , Rating: 2
From Wikipedia:
"As amber matures over the years, more polymerization will take place as well as isomerization reactions, crosslinking and cyclization. The average composition of amber leads to the general formula C10H16O."

ChemC


RE: No Jurassic Park
By MagnumMan on 2/2/2009 3:48:31 PM , Rating: 2
Would seem that something so important and something so complex would have built-in error redundancy. All we need to do is figure out the DNA ECC algorithm!


RE: No Jurassic Park
By Chemical Chris on 2/2/2009 6:50:24 PM , Rating: 4
There is a natural built-in error redundancy. Many genes are 'padded' by extraneous base pairs around important genes, for example.
But mainly, while we are living, various enzymes ensure that DNA is maintained, there are quite a few of them.
So there is no ECC algorithm, as stuff gets broken, it gets fixed.
The mechanism is complicated, but I may post one or two later....I could use the practice (Biochem midterm tmrw AM)


RE: No Jurassic Park
By Danish1 on 2/2/2009 10:51:29 PM , Rating: 2
I'd vote you up if I could ChemC.

Thanks for an informative read.


"DailyTech is the best kept secret on the Internet." -- Larry Barber














botimage
Copyright 2014 DailyTech LLC. - RSS Feed | Advertise | About Us | Ethics | FAQ | Terms, Conditions & Privacy Information | Kristopher Kubicki