backtop


Print 101 comment(s) - last by FaceMaster.. on Feb 9 at 3:41 PM


Scientists have cloned a Pyrenean ibex, an extinct genetically distinct subspecies of the Spanish ibex, shown here. The ibex, known for its curved horns went extinct in 2000. Scientists resurrected it with a skin sample, though it was born with a lung defect and soon died.  (Source: Jose Luis GOMEZ de FRANCISCO/naturepl.com)
New cloning work could clear the way for resurrection of many recently extinct beasts

In the realm of commercial cloning, trickled-down technology from this cutting edge field of research has allowed firms to offer pet cloning services.  And in the realm of research, tremendous advances continue as scientists are hatching plans to resurrect extinct beasts.  Scientists have almost finished mapping the Woolly Mammoth genome, and have already injected DNA from an extinct species into a mouse.

Now arguably the greatest landmark event for the field of cloning has occurred.  Scientists have for the first time cloned an extinct animal, the Pyrenean ibex, a form of wild mountain goat.  The really spectacular thing about this cloning effort is that it was done using only DNA from skin samples. 

Technically classed as a genetically distinct subspecies of the Spanish ibex, the Pyrenean ibex, or bucardo as it is called by the locals, used to roam the mountainous hillside of northern Spain.  Known for its distinct horns, the animal was a popular target for hunters, and by the 19th century only 100 were left.  The species was not declared protected until 1973, at which time there were around 30 animals.  In 2000, the last known member of this critically endangered species was found dead on a hillside.  Researchers at the time decided to wisely preserve skin samples in liquid nitrogen.

The well-preserved skin samples proved a fruitful source for DNA.  Replicating this DNA using common genomic techniques, the researchers injected it into goat eggs, replacing the goat DNA.

While a great success, the effort also showcased the difficult road ahead for producing viable clones.  While born alive, the newborn ibex kid had defects in its lungs, similar to those found in many cloned sheep, and they proved fatal.  However, as some sheep clones have lived relatively normal lifespans, the success raises the hope of a more permanent resurrection.

Dr Jose Folch, from the Centre of Food Technology and Research of Aragon helped lead the research.  He states, "The delivered kid was genetically identical to the bucardo. In species such as bucardo, cloning is the only possibility to avoid its complete disappearance."

Professor Robert Miller, director the Medical Research Council's Reproductive Sciences Unit at Edinburgh University who heads a northern white rhino cloning effort funded by the Royal Zoological Society of Scotland cheered the news.  He states, "I think this is an exciting advance as it does show the potential of being able to regenerate extinct species. Clearly there is some way to go before it can be used effectively, but the advances in this field are such that we will see more and more solutions to the problems faced."

The race is now on to make sure that critically endangered species' tissues are preserved for future cloning efforts.  Britain's Zoological Society of London and America's Natural History Museum have teamed up in a project called Frozen Ark.  They are in the process of storing samples from thousands of species.

While cloning a dinosaur is highly improbable due to DNA's chemical tendency to rapidly break apart to the point where it cannot be sequenced, this new breakthrough paves the way for cloning of both endangered species, and extinct species with fully sequenced genomes, such as Neanderthals or, likely soon, the Woolly Mammoth.  However, this new work also highlights the extreme challenge ahead in trying to establish a sustainable population of a cloned animal, or even clones that live to reach adulthood.



Comments     Threshold


This article is over a month old, voting and posting comments is disabled

Why lungs defective?
By MBlueD on 2/2/2009 8:33:01 AM , Rating: 2
Why do cloned animals have lung defects?




RE: Why lungs defective?
By kontorotsui on 2/2/2009 8:35:33 AM , Rating: 5
Because DNA copies are not always exact. And making them from already bad copies, like the skin, is not the same as a "fresh" newly made DNA from male and female gametes.
Skin cells can work with bad/corrupted "lung data" in the code, as they won't use it, but it's too bad for a newborn to start with that bad code.


RE: Why lungs defective?
By LRonaldHubbs on 2/2/2009 8:46:17 AM , Rating: 5
I think the question was more about why there are lung defects, not just why there are defects in general. The article noted that lung defects are common in cloned sheep. I too am curious why the lungs in particular are commonly defective.


RE: Why lungs defective?
By Master Kenobi (blog) on 2/2/2009 8:54:04 AM , Rating: 5
Probably due to complexity. Lungs are quite advanced organs compared to many others.


RE: Why lungs defective?
By phazers on 2/2/2009 10:25:42 AM , Rating: 5
In mammals, I would think the brain would be the most advanced organ...


RE: Why lungs defective?
By jRaskell on 2/2/2009 11:07:17 AM , Rating: 5
It's likely the fetus would never reach birth with a truly defective brain, where-as organs such as the lungs don't really have an affect on viability until birth, at which point they have to be used.

It's also possible a number of other organs were defective as well, but those organs won't have as immediate an affect on the life of the clone as the lungs do. If you can't breath, you're going to die rather quickly. If your kidneys or liver don't work, you'll live much longer before they start becoming a problem.


RE: Why lungs defective?
By masher2 (blog) on 2/2/2009 11:10:58 AM , Rating: 3
While your other points are valid, a fetus can be viable with a heavily damaged (or even nonexistent) forebrain. The relatively small brain stem is the part required for basic life functions.


RE: Why lungs defective?
By teldar on 2/2/2009 2:45:19 PM , Rating: 2
This would allow them to possibly live to reproductive maturity so they could be inseminated and produce viable offspring.


RE: Why lungs defective?
By Suntan on 2/2/09, Rating: -1
RE: Why lungs defective?
By afkrotch on 2/2/2009 12:23:49 PM , Rating: 5
Ya, like the ppl that have a signature of just their name, when it's already show.

- afkrotch (hizzahahahaha!!!!)


RE: Why lungs defective?
By Suntan on 2/2/09, Rating: -1
RE: Why lungs defective?
By justinmcg67 on 2/2/09, Rating: 0
RE: Why lungs defective?
By GodisanAtheist on 2/2/2009 6:37:21 PM , Rating: 4
He missed one letter in one of his posts while you intentionally type 6 at the end of each of yours.

Its OK not to have a witty comeback each and every time.


RE: Why lungs defective?
By nugundam93 on 2/4/2009 7:15:16 AM , Rating: 2
love those times when the pot and kettle get together and start calling each other names. :D


RE: Why lungs defective?
By cochy on 2/2/2009 12:30:16 PM , Rating: 5
Me no brain?

hahaha hahahahah

Why I laugh?


RE: Why lungs defective?
By DonkeyRhubarb on 2/2/2009 12:50:49 PM , Rating: 5
Me fail English?

That's unpossible!


RE: Why lungs defective?
By kenji4life on 2/2/2009 8:55:49 PM , Rating: 2
"My cat's breath smells like catfood!!!"

My favorite from Homer:

"I am so smart, I am so smart, I am so smart, I am so smart, S-M-R-T, I mean, S-M-A-R-T."


RE: Why lungs defective?
By unrated on 2/2/2009 2:43:27 PM , Rating: 2
I think you are misunderestimating us.


RE: Why lungs defective?
By teldar on 2/2/2009 2:44:00 PM , Rating: 2
You would think so.... however.... Who have you talked to today and how have they made you feel?


RE: Why lungs defective?
By rcc on 2/3/2009 1:45:49 PM , Rating: 2
quote:
In mammals, I would think the brain would be the most advanced organ...


Well, yes, but.... have you ever tried to give an IQ test to a sheep, or goat?

:)

Seriously though, you have a point, but it is a pretty simple brain.


RE: Why lungs defective?
By Aloonatic on 2/2/2009 9:40:02 AM , Rating: 2
There probably are many many many other problems that aren't highlighted.

I guess that lung complaints show up earlier than others. If your lungs are inherently defective then you aren't going to last long, at least not long enough for other complaints to show up that clearly.

<probably really poor analogy>

Kinda like a PSU being defective, without the power getting into a system correctly then you aren't going to find out if there are too many problems elsewhere that easily. Distinguishing between the effects of one faulty part on other parts and the damage that was there beforehand may not be that simple.

</ probably really poor analogy>


RE: Why lungs defective?
By Pneumothorax on 2/2/2009 10:12:03 AM , Rating: 3
Another factor is also lung defects most likely would kill the clone after birth, as the mom is "breathing" for the fetus until it's born. I'm pretty sure there other clones who died in utero prior to this one from other defects that would kill the fetus earlier in development.


RE: Why lungs defective?
By Murloc on 2/2/2009 10:32:09 AM , Rating: 3
The sheeps also had artrosis.
I think this kind of research is important, it would be cool to have a perfect mammoth.
More food in nordic countries.


RE: Why lungs defective?
By SoCalBoomer on 2/2/2009 3:36:11 PM , Rating: 1
DOH - sorry, I clicked NOT instead of Worth! Sorry - I was thinking the same line as you were and think it's a great comment. :(


RE: Why lungs defective?
By genedude on 2/2/2009 12:45:21 PM , Rating: 2
A viable organism needs a good DNA sequence AND good imprinting, which refers to the turning on and off of critical genes. The imprinting process depends on the sex or the organism, environment, and other incompletely understood factors. Many cloned animals have a few “organ development” genes that are incorrectly imprinted, resulting in malformations. As another poster suggested, many organs are affected, but the lung malformations are more lethal in the newborn period.

On a side note, humans who have imprinting problems in a few genes can have serious issues—Google Image “Prader-Willi” and “Beckwith Wiedemann”. The latter syndrome is increased in babies conceived by in vitro fertilization, which is a thousand times less complex than cloning.


RE: Why lungs defective?
By Ictor on 2/2/09, Rating: 0
RE: Why lungs defective?
By JS on 2/2/2009 7:11:35 PM , Rating: 2
Why would the meat be any worse for consumption just because its DNA is not 100% correct? It's not like your stomach or your taste buds care about DNA spirals, unless they directly affect the quality of the meat. And if the quality of the meat is low it will probably not sell very well.

If the cloned cows are not suffering and the meat quality is ok, I wouldn't mind eating cloned meat.

Personally I'm looking forward to the day when we can grow filet mignon without the cow in a vat. Then the whole world can hopefully enjoy meat without the immense environmental impact of grazing cattle.


RE: Why lungs defective?
By masher2 (blog) on 2/2/2009 10:42:49 PM , Rating: 2
quote:
Then the whole world can hopefully enjoy meat without the immense environmental impact of grazing cattle
Yet another example of environmental idiocy, eh? By blocking the nascent nuclear power industry, they essentially doubled world carbon emissions over the last 30 years. Now, they're doing their best to block bioengineering, the one advance that has more potential to reduce human impact on the planet than any other.


RE: Why lungs defective?
By Myg on 2/3/2009 7:00:35 AM , Rating: 2
"Now, they're doing their best to block bioengineering, the one advance that has more potential to reduce human impact on the planet than any other"

Did you just say "reduce"?

So, by forcefully altering the natural balance that has come about after countless years of adaptation, we can reduce our impact?

Masher; did you even think before you wrote that?


RE: Why lungs defective?
By masher2 (blog) on 2/3/2009 10:13:19 AM , Rating: 3
quote:
Did you just say "reduce"?
Yes, quite clearly. A new variant of corn with higher yields could dramatically reduce the amount of cultivated land needed. It could reduce the amount of water, (fossil-fuel based) fertilizer or pesticides needed as well.

Currently, meat farming alone accounts for more pollution and emissions than does the entire transportation sector-- cars, trucks, buses, planes and trains all combined. Biotech has the ability to eliminate that entirely.

quote:
by forcefully altering the natural balance
Ah, the myth of the "delicate balance of nature" arises again. Nature is always changing. And introducing a new variant of corn isn't going to lead to any more disruption than a new breed of dog or goldfish would do -- something we've done through forced breeding countless times already.


RE: Why lungs defective?
By Myg on 2/3/2009 10:34:23 AM , Rating: 1
Indeed, but we didn't create nature; so we don't direct its evolution/direction. Nor have the knowledge/understanding to fiddle with such things beyond its normal working parameters (mixing viable/breedable creatures).

Bioengineering is a step too far, its going beyond the barriers placed down by nature in the first place (probably for its own protection/balance ;-) ). It can only lead to huge short term gains and catastrophic long term situations.


RE: Why lungs defective?
By masher2 (blog) on 2/3/2009 11:08:37 AM , Rating: 5
quote:
Nor have the knowledge/understanding to fiddle with such things
We didn't have the knowledge to "fiddle with" electricity in the 1600s, or steam engines in the 1700s, or fossil fuels in the 1800s, or even computers a scant 50 years ago. We learned as we went along...and as a result, our lives are immeasureably more pleasant, comfortable, and civilized than ever before in history.

Now, it seems a growing segment of our population is not only too ignorant and fearful to make new advances, but they actually want to roll back the ones we've already made. One can only hope this pernicious, short-sited philosophy dies out before it does more harm than it has.


RE: Why lungs defective?
By mead drinker on 2/5/2009 2:43:26 PM , Rating: 2
quote:
Now, it seems a growing segment of our population is not only too ignorant and fearful to make new advances, but they actually want to roll back the ones we've already made. One can only hope this pernicious, short-sited philosophy dies out before it does more harm than it has.

Masher, this philosophy is not new. One only has to cite Sagan's discourse at the library of Alexandria to hear the same prophetic words, and witness the sheer absurdity that these groups encompass. The tempering of technological advancement and human complacency is itself a question founded in existentialism. The only thing that has changed is the outlet that these people are attempting to "preserve," most recent the environment. The good thing is that progress still continues today despite the machinations of these ignorant people. The sad thing is without the avarice of corporations, government, and empires none would be made.


RE: Why lungs defective?
By Myg on 2/6/2009 7:46:06 AM , Rating: 2
Bio-engineering is like trying to hex edit compiled code to force it to adapt to your needs, without having the source code.

You may get a function working in a way you want for a while, but it may be impossible to predict how that change will carry over to the rest of the program as it pans itself out in time.


RE: Why lungs defective?
By Myg on 2/6/2009 7:46:14 AM , Rating: 2
Bio-engineering is like trying to hex edit compiled code to force it to adapt to your needs, without having the source code.

You may get a function working in a way you want for a while, but it may be impossible to predict how that change will carry over to the rest of the program as it pans itself out in time.


RE: Why lungs defective?
By Spivonious on 2/6/2009 11:08:57 AM , Rating: 1
Exactly, hasn't anyone else read Jurassic Park? No one on the team thought that the frog DNA would cause problems, after all the dinosaurs were perfectly healthy females at birth.


RE: Why lungs defective?
By Ictor on 2/6/2009 2:01:05 PM , Rating: 2
quote:
One can only hope this pernicious, short-sited philosophy dies out before it does more harm than it has.


How about a long-sited philosophy. Look at the extreme version of biotech. In the extreme version, genes of many unrelated species (incl. human) are inserted into the dna of, for instance, a bacteria. If such a lifeform is created, with the ability to reproduce itself and on top of that escapes into the enviroment. Can you predict what the outcome will be? Will it be a "new" lifeform taking it's place in the eternal battle for the fittest or will it be a biological disaster.

My guess is the last option. A long-sited philosophy says, that when the extreme version of a technology is a deadly disaster, than a small dose of that same technology in the long run and widespread use won't be any better.

Biotech will someday leave the minds of people as the solution for mankinds problems because reason says it will.


RE: Why lungs defective?
By William Gaatjes on 2/3/2009 3:52:59 PM , Rating: 2
quote:
Currently, meat farming alone accounts for more pollution and emissions than does the entire transportation sector-- cars, trucks, buses, planes and trains all combined. Biotech has the ability to eliminate that entirely.


I personally would love to see a bio-technology that allowed us to build steaks or any other kind of meat that tastes the same and has the same texture as for example an used grown muscle. That would make the meat farming no longer necessary and be much more efficiënt and reduce the pollutions and emissions. Instead of growing an entire animal we would just grow steakes.

For the vegeterians among us a reason to cheer because they will be able to eat meat too. But since the animals in meat farming are used for almost 100% for various industries, we have to use biotech to provide substitutions for those industries as well. But that is all details. And no, we would be just replacing jobs and not killing jobs.


RE: Why lungs defective?
By mac2j on 2/2/2009 3:11:34 PM , Rating: 1
It seems to be an issue with this particular type of animal - sheep/goats etc as lung defects are not the main problem cloning - for example - dogs or cats.

The reason is basically this -- when you take Skin DNA it has to be re-programmed to be 'anything' DNA which can give rise to a whole new organism. Ungulate DNA seems to have an issue with getting the particular part of DNA that regulates early lung development fully reprogrammed.


Useless
By kontorotsui on 2/2/2009 8:33:07 AM , Rating: 2
How are they supposed to "save" the species, if they clone only one?
Even if they cloned a male and a female, genetical variety would be not enough.




RE: Useless
By JasonMick (blog) on 2/2/09, Rating: 0
RE: Useless
By Aloonatic on 2/2/2009 9:55:52 AM , Rating: 3
I think (yes, more guess work from yours truly) that this kind of technology will follow the same sort of arc as potential time travel.

Namely, it is only possible to go backwards from the time that the technology was created forwards :-s.

Basically, the only way that a diverse enough range of DNA samples for extinct animals will be collected is when they are collected from animals before the become extinct, who are on the verge of extinction right now, so that they can be cloned again in the future should current breeding programs fail.

If you catch my drift :-s


RE: Useless
By Schrag4 on 2/2/2009 10:17:12 AM , Rating: 2
"The building will have to be at least, 3 times bigger."

(I'm sure I botched the quote)


RE: Useless
By CascadingDarkness on 2/3/2009 12:15:26 PM , Rating: 2
quote:
...DNA typically breaks apart very rapidly...


Duh, that's why we put frog DNA in place of the missing parts.

Jez, was I the only one paying attention during the start of the tour, before everyone got eaten?


RE: Useless
By therealnickdanger on 2/2/2009 9:41:46 AM , Rating: 3
Geez... if you're going to clone an extict species, make it something awesome. T-Rex!!!


RE: Useless
By bjacobson on 2/2/2009 10:48:51 AM , Rating: 2
No thanks! They're already doing crazy stuff--
"and have already injected DNA from an extinct species into a mouse."

Mouse Mammoth? Wooly mouse? Creepy!


RE: Useless
By joemoedee on 2/2/2009 11:17:14 AM , Rating: 2
Isn't there typically a reason why a species went extinct to begin with?


RE: Useless
By Motoman on 2/2/2009 12:13:00 PM , Rating: 5
Sure. But whether a species went extinct because of natural or man-made circumstances, it is still valuable to study them. Not to mention cool as hell.

Somebody cloning their yellow lab is something I can't really get behind. We have plenty of yellow labs. Clonging, say, a Tasmanian tiger...well, that would be extremely interesting.


As if once wasn't enough...
By mal1 on 2/2/2009 10:01:41 AM , Rating: 5
Humans have now caused this species to go extinct twice in less than a decade.




RE: As if once wasn't enough...
By Master Kenobi (blog) on 2/2/2009 10:03:04 AM , Rating: 3
Natural Selection in action. Learn it, live it, love it.


RE: As if once wasn't enough...
By TSS on 2/2/2009 10:55:54 AM , Rating: 2
well... techinically....

if where able to clone extinct species now (granted with defects but they will find a way to solve that as cloning from skin cells used to be entirely unthinkable) wouldn't that turn into Human Selection?

afterall natural selection = the weak die. if we keep ressurecting them....


By foolsgambit11 on 2/3/2009 1:27:24 PM , Rating: 2
You're using too narrow of a definition of 'weak'. Or maybe 'natural'. The strength the resurrected animals have is the ability to appeal to humans who want to bring them back. That's an important skill. Almost as important as a cow's ability to taste good, which has vastly increased its population and range.

As for the 'natural' definition, humans are part of nature. Our selections are natural selections.

There's nothing inherently brilliant about natural selection. Nature isn't smart. It doesn't know what it's doing, and it doesn't always do the right thing. (Technically, it's not animate, so it doesn't do anything.) After all, if natural selection were so brilliant, it wouldn't have made humans in the first place, right?


By masher2 (blog) on 2/2/2009 10:54:03 AM , Rating: 5
Except that this isn't a separate species, no more than your dog Matilda is, simply because she has three white spots on her left foreleg.


RE: As if once wasn't enough...
By Alphafox78 on 2/2/2009 11:21:13 AM , Rating: 2
Wheres a pally when you need one? battle rez


RE: As if once wasn't enough...
By Whaaambulance on 2/2/09, Rating: 0
RE: As if once wasn't enough...
By barclay on 2/2/2009 1:00:24 PM , Rating: 2
> "...world of warcraft reference"

Warcraft III reference

http://www.battle.net/war3/human/units/paladin.sht...


By otispunkmeyer on 2/2/2009 9:49:22 AM , Rating: 4
its like environmentalists trying to save some dying out species today. theres usually a good reason its dying out...it just wasnt meant to be. (though i do agree somewhat with those trying to stop poaching of animals)

i read an example about some australian swamp toad and animalists wanting to save it. truth is this thing was just super inane, wasnt particularly clever and seemed to have little compulsion to mate. basically, mother nature had doomed it to extinction...natural selection, survival of the fittest and all that. its natural end was to stop existing.

but in trying to save it, they spent a lot money basically working against nature. stupid. what a waste.

i swear some environmentalists take things so far that they are actually altering/damaging the thing theyre trying to save in the process.




By masher2 (blog) on 2/2/2009 10:30:19 AM , Rating: 5
Also left out is the fact that this particular creature is just a subspecies of Spanish ibex in general. In recent years, environmentalist-minded biologists have been playing the "species game" where they define trivial variations in a population as entirely separate species, so they can justify their protection under the Endangered Species Act.

There are a few hundred different breeds of dogs. All can fertilely interbreed, just as all the various Ibex species can (actually Ibex can also interbreed with goats and turs as well). Should every breed of dog be considered a separate species, entitled to legal protection?


By masher2 (blog) on 2/2/2009 1:29:50 PM , Rating: 5
quote:
a lot of dog breeds, if not most of them, are so inbred that they do not make a separate species
Why not? Genetically, a poodle varies much more from a Labrador than a Pyrenean Ibex does from a Spanish Ibex.
The old test of viability of offspring may not have been a perfect standard, but at least it was a standard. Now, we have nothing. No rules.

How much variation should be required to define a new species? Every plant and animal is genetically distinct. With these new policies taken to their logical conclusion, every time an animal dies, one can say a "species" has gone extinct.

One of the most blatant cases of species gerrymandering was the famous spotted owls debacle. In this case, even the fiction of genetic variation wasn't used. The "species" was defined by which side of a highway the owls were found on. Live on this side, and you're a California Spotted Owl, thriving and in no need of protection. Fly across the highway, and the bird instantly becomes a "Northern" Spotted Owl, in need of special protection-- protection which resulted in massive restrictions to the lumber industry.


By ayat101 on 2/2/2009 10:40:02 PM , Rating: 2
Nonsense... read up the test for new species: viability and stability, plus some breeding isolation. Inbreeding with other species is not a counterargument. That was your argument and it was wrong. Simple.

Don't know how you worked out that these two goats are less related than poodle et al... care to provide a reference?

It's a bit pointless discussing science with you, because repeatedly you make obvious mistakes (i.e. you do not know the basic accepted principles of the area you are talking about... and then when these accepted principles disagree with your OPINION you blame enviromentalists or greenpeace).

PLUS... your peanut gallery and cult of Masher on these boards downrates the posts that disagree with you. It is ridiculous that when I post the accepted scientific view I get downrated... and you get uprated for opposing science. It is downright cultist behaviour.


By masher2 (blog) on 2/2/2009 11:26:06 PM , Rating: 2
quote:
read up the test for new species: viability and stability...
This "species" was obviously neither viable nor stable. So much for that argument.

quote:
plus some breeding isolation
Any purebred breed of dog has more breeding isolation than most of the multitudinous subspecies of mountain goats.

quote:
Don't know how you worked out that these two goats are less related than poodle et al
When it takes a trained biologist and a physical exam to tell the difference between two "species", there isn't much of a difference. In fact, the only functional difference between all four of the subspecies of Capra pyrenaica is which part of the Iberian Peninsula they lived in.

quote:
It's a bit pointless discussing science with you
But you're not discussing science. You're simply tossing insults.

If you want to debate, why not try an actual fact, logical counterargument, or reasonable facsimile thereof? For starters, why not dispute my assertion that there is no reasonable criteria for differentiating between the 'Northern' Spotted Owl and the 'California' Spotted Owl? They're essentially the same bird, defined only by which side of a road they happen to be on at the time.


By lucasb on 2/3/2009 2:04:01 PM , Rating: 2
quote:
It's a bit pointless discussing science with you

Couldn't agree more. Arguing about science with Masher is useless. He's full of free market rhetoric and other (deeply) flawed ideological biases. There are only three choices: he knows next to nothing about real science, he suffers some sort of delusional disorder or he's a shill for some interest group.
You can clearly see this on his posts, blog entries and articles on climate change:
- According to him, consensus building has no place within science, yet he's eager to mention the "growth" in the number of skeptical scientists. To discover the truth you don't need a popularity contest but you would be a fool to ignore the findings and arguments from a vast number of educated, informed people coming from different backgrounds.
- Masher doesn't waste time trying to link (explicitly or implicitly) climate change to some sort of conspiracy theory (environmental fanaticism, liberal conspiracy, interest groups which may be benefited with a switch to a green economy). He has the opinion that Wikipedia put an army of "environuts" to patrol the articles on environmentalism and global warming against modification.
At the same time, every time someone shows a possible link between researchers quoted by him with a right-wing think tank, Big Oil or another organization known to attack mainstream science when their business models come under public light as being harmful to the common good (e.g., second-hand smoke) he quickly dismisses these findings as ad hominem attacks.
- There are countless examples of Masher cherry-picking whole papers or parts of them, distorting facts and presenting anecdotal evidence as unquestionable proof.
- He's quick to change his talking points when the research doesn't agree with his rethoric or when someone articulates a well-argued critique to his "articles". If warming is indeed happening, it shouldn't be a problem, since (according to his diatribe) a warmer globe is good for us (more rainfall and whatnot). If ice levels are rising, that's enough to discredit mountains of research. He ignores that a warmer climate may cause more snowfall thus leading to temporary recoveries on ice levels. He ignores that as water from melting ice enters the oceans, the concentration of salt on sea water becomes lower thus elevating the freezing point of the sea causing temporary surges on sea ice. And so on.
quote:
PLUS... your peanut gallery and cult of Masher on these boards downrates the posts that disagree with you. It is ridiculous that when I post the accepted scientific view I get downrated... and you get uprated for opposing science. It is downright cultist behaviour.

DT's readership is mostly right-wing leaning (the social phenomenon of cyber libertarians), so it's reasonable to expect a lot of cheerleaders when Masher performs some of his stunts.


No Jurassic Park
By Chemical Chris on 2/2/2009 12:39:57 PM , Rating: 3
quote:
While cloning a dinosaur is highly improbable due to DNA's chemical tendency to rapidly break apart to the point where it cannot be sequenced

This is half-correct. Dinosaur's will never, ever, ever be cloned. The bones arent 'bones', they are essentially rocks. There is no trace of DNA. However, they have found 'fossils' where the DNA is visible, or rather, the imprint of where the DNA was is visible. But there is no DNA, and the fine detail needed to extract which base was in each position is long gone. So, anything that's been extinct for a few million years is never going to come back. Its one of lifes little unsolvable mysteries.
On the other hand, cloning long-dead animals may prove possible. In an average cell, there are ~10000 depurinations/24hr, a result of thermodynamics/equilibrium (purines are the A and G bases, pyrimidines are the C, U, and T bases). Normally, the cells DNA repair machinery repairs these errors. Once you die, this stops, and errors accumulate. Please note that the rate of depurination is not constant, the rate of loss decreases with time....think of it like half life of a radioactive element.
So, while there are some samples of Mammoth DNA, it is quite hard to get a viable sequence out of it, due to the loss of so many bases. One DNA sample will never be enough to get a working copy.
However, all is not lost. Some techniques I'm learning (Ive almost completed by Bachelors in Biochem, planning on a Masters) include sequencing what you have, from many seperate sources, and then using a computer to figure out which sequences overlap, and using hte information from the two incomplete sequences to generate a more complete sequence. IE:
____ATACGCATA___AGATAC_____AGTCG +
ATGC___CGA__ACTGAGA__CAGATAAG___ =
ATGCATACGAATACTGAGATACAGATAAGTCG
So while each piece by itself is essnetially useless, by sequencing as much as possible, and using a computer to figure out how it bests fits together, a viable sequence can be obtained (IIRC this is called Shotgun Sequencing, and is pretty quick, cheap, and effective, thanks to powerful computers). Computer power required is immense: A human genome has ~40 Billion base pairs....so there is a lot of math and memory required)
But, just shotgun sequencing isnt really enough for badly degraded DNA, like the mammoth. So, we need more tools. Enter comparative genomics; we take a closely related set of animals (an elephant), and compare the DNA which is missing data from the mammoth, with homologous (similiar) sequences in the elephant. You may have heard how we share 99.7% of our DNA with chimps; much of the DNA is conserved, only slight differences account for the different morphologies. So, an enzyme in a mammoth that converts A to B, and is also present in elephant, will likely be very similiar. So, you compare the two (as in the previous DNA comparison example), and use the living species to 'fill in the blanks' of the ancient species. The mammoth DNA takes precedence, if available. While comparing to an elephant may introduce some mistakes, these are often inconsequential. Of course, they're often show-stoppers to.
So, even if we cant figure out a complete sequence from many partial mammoth sequences, we should be able to fill in the blanks with elephants, and clone a mammoth.

In conclusion, cloning a wooly mammoth is possible, and will likely be completed relatively soon. Which is cool. But dinosaurs, or anything which we do not have organic remains of, will never be cloned. Never ever ever. Which is sad. But, C'est la vie!

ChemC




RE: No Jurassic Park
By Larrymon2000 on 2/2/2009 1:15:18 PM , Rating: 2
Well they thought of this in Jurassic Park as well. it's not as if they found some fossils and ran it through the clon-o-tron. They found preserved blood inside a mosquito solidified in amber. Of course, this is a FAR stretch as there's no guarantee you'd ever even be able to find mosquitos trapped in amber, much less mosquitos with SO many species of blood!


RE: No Jurassic Park
By Chemical Chris on 2/2/2009 3:12:05 PM , Rating: 4
Sorry, but Im afraid you don't fully understand thermodynamics. Im not being condescending, its a very geeky pursuit, and very, very few people *fully* understand....there's lots of math based on greek symbols, so the expression "It all looks Greek to me" is quite apt, lol ;)
5652182
But anyway, at the atomic scale, electrons and photons are flying around at nearly the speed of light, and all the atoms are vibrating, jostling, bumping into each other, inter-atom bonds are vibrating, stretching and compressing, bending, electrons are flying around conjugated systems, and so on.
But I digress. In order for a reaction to occur, the reactants must be in exactly the right orientation, with their electronic configuration exactly as it needs to be, then a reaction occurs. Its all about probability. The probability is generally quite low, but since billions upon billions of them happen every second, eventually, it happens. The only way it doesnt happen is if the system has 0 energy: that is, its temperature is absolute zero (~ -273C), and all subatomic movement has ceased....this is currently theorized to be impossible. Otherwise, its just a matter of time.
In fact, even in minerals (stuff that is a solid crystalline lattice), where all the atoms are nicely organized in exactly the same way throughout the lattice, bonds are being broken and reformed all the time. But since when a bond breaks, the probability of an adjacent bond breaking, and having the suitable conditions to create a different/new bond, is quite low. So, the bond breaks, then re-bonds the same one that was broken.
In organic material, there is no crystalline lattice, things (chunks) are floating around in what is essentially a thick soup....mmmm chunky soup :) There are also many reactive species, like carbonyl compounds, nitrogen species, and so on. So, over time, it will just become a pile of oil, then rock.
And there is No Way you would be able to find the conditions naturally for such a complex single chemical molecule (DNA) to last >60million years. Even artificially, it would be tough.
And besides, amber didnt start as amber, did it? It was a mix of complex and simple organic compounds from trees, which had the unlikely probability of appropriate conditions for amber to form (but some always does!). All those organic molecules, over time, interacted to form the more stable things (many factors affect the most stable configuration.....complex ones arent stable, such as DNA). So, now the amber is made up of all kinds of cool compounds, which look very little like the original. Any live bug trapped inside would undergo similar changes, and would likely have a 'rocky' composition. You might even be able to make out the outline of where DNA fibers were, but rest assured, there is no fine detail. But we have been able to see how many chromosomes some species had, which is quite interesting to evolutionary biologists anyhow.

Short Version: The disorder of the system will always increase.

ChemC


RE: No Jurassic Park
By Chemical Chris on 2/2/2009 3:13:31 PM , Rating: 2
From Wikipedia:
"As amber matures over the years, more polymerization will take place as well as isomerization reactions, crosslinking and cyclization. The average composition of amber leads to the general formula C10H16O."

ChemC


RE: No Jurassic Park
By MagnumMan on 2/2/2009 3:48:31 PM , Rating: 2
Would seem that something so important and something so complex would have built-in error redundancy. All we need to do is figure out the DNA ECC algorithm!


RE: No Jurassic Park
By Chemical Chris on 2/2/2009 6:50:24 PM , Rating: 4
There is a natural built-in error redundancy. Many genes are 'padded' by extraneous base pairs around important genes, for example.
But mainly, while we are living, various enzymes ensure that DNA is maintained, there are quite a few of them.
So there is no ECC algorithm, as stuff gets broken, it gets fixed.
The mechanism is complicated, but I may post one or two later....I could use the practice (Biochem midterm tmrw AM)


RE: No Jurassic Park
By Danish1 on 2/2/2009 10:51:29 PM , Rating: 2
I'd vote you up if I could ChemC.

Thanks for an informative read.


the lack of imagination
By dare2savefreedom on 2/2/2009 9:11:44 AM , Rating: 2
so i'm a scientist and i clone a sheep? WTF? !FTW

if people had imagination they would clone marilyn monrone.




RE: the lack of imagination
By ninus3d on 2/2/2009 9:27:17 AM , Rating: 3
Brain/imagination would not be the organ in use causing anyone to wanna clone Monroe ;)


RE: the lack of imagination
By ayat101 on 2/2/2009 10:22:02 AM , Rating: 2
DuH! Imagination would play a BIG part in it :) Before and after...


RE: the lack of imagination
By djc208 on 2/2/2009 11:40:35 AM , Rating: 4
What are you going to do with a Marilyn Monroe baby? Wait, maybe I don't want to know.

Seriously she's not going to step out at 20 educated and horny. Besides, there are plenty of other women just as hot out there already that neither of us would stand a chance with, so why go through the trouble.


RE: the lack of imagination
By afkrotch on 2/2/2009 12:32:33 PM , Rating: 1
Cause you get to raise her how you want and by the time you're 40-50, you get to do whatever you want with her. Now is a clone property or does it have it's own life?


RE: the lack of imagination
By mindless1 on 2/3/2009 1:17:16 AM , Rating: 2
That's still sick, I guess you've never raised a child.


RE: the lack of imagination
By johnsonx on 2/2/2009 8:10:55 PM , Rating: 2
if I were a scientist I'd clone mint sauce


Waste of time
By pomaikai on 2/2/2009 9:59:36 AM , Rating: 2
This is a huge waste of time. The species became extinct for a reason. If we have such a hard time saving an endangered species and keep it from becoming extinct what makes us think we can actually bring them back without them dying off again.




RE: Waste of time
By ayat101 on 2/2/2009 10:29:49 AM , Rating: 5
Your opinion makes NO sense... the article clearly states the species was hunted towards extinction and only died out when its numbers were reduced too far. Hence the species died out because of human influence, and not due to some inherent fault or natural selection.


RE: Waste of time
By joemoedee on 2/2/2009 11:21:19 AM , Rating: 2
Isn't hunting still technically "natural selection"? Even if it's humans with high powered rifles doing the hunting, it's still a survival of the fittest situation. Look at deer. There are plenty of hunters out there, yet the deer population grows. They're just better at adapting to their current environment than other species.

Just because tools are involved, it doesn't mean the same rules don't apply.


RE: Waste of time
By Suntan on 2/2/2009 11:50:33 AM , Rating: 1
quote:
Just because tools are involved, it doesn't mean the same rules don't apply.


But there are rules to hunting deer. Have you ever seen how quickly their numbers can vanish in an area where the DNR purposely opens up hunting restrictions to help keep the population in check?

-Suntan


RE: Waste of time
By SlyNine on 2/2/2009 1:13:52 PM , Rating: 2
Yes but humans introduce an imbalanced and overwhelming element. The balance is humans should be smart enough to understand that their actions can lead to greater influences and impacts. Then hopefully take steps to avoid or correct those mistakes or imbalances caused by us. Maybe theirs a reason humans believe they are responsible for every small change in the weather, Maybe that's mother natures way of balancing things out.


Article Picture
By dflynchimp on 2/2/2009 8:42:01 AM , Rating: 2
Dude, I highly doubt anyone would want to clone the Geico Caveman. He's not even't a real caveman! Just some butt-ugly bum they found.




RE: Article Picture
By Master Kenobi (blog) on 2/2/2009 8:53:13 AM , Rating: 3
Article should have had Jurassic Park on it. This is definately in their territory.


RE: Article Picture
By PitViper007 on 2/2/2009 11:11:43 AM , Rating: 2
I don't know, I saw that picture and thought, "It must be so easy even....." You fill in the rest.


RE: Article Picture
By porkpie on 2/2/2009 1:42:28 PM , Rating: 2
quote:
He's not even't a real caveman!
Really? You sure? I thought they dug up a real caveman for the part myself.


one step closer
By omnicronx on 2/2/2009 9:34:57 AM , Rating: 3
One step closer to getting that pet Velociraptor I've always wanted ;)




RE: one step closer
By AssBall on 2/2/2009 9:42:11 AM , Rating: 2
I'll take a trilobyte :D


First time I read this, I LOL!
By frobizzle on 2/2/2009 10:29:52 AM , Rating: 1
quote:
Scientists have almost finished mapping the Woolly Mammoth genome, and have already injected DNA from an extinct species into a mouse.

It almost sounded like they took the Wooly Mammoth DNA and implanted it in a mouse! You have to feel for that poor pregnant mouse! ROFL!




RE: First time I read this, I LOL!
By Curelom on 2/2/2009 11:48:37 AM , Rating: 2
I don't think bed rest would be enough to make it through the pregnancy.

Dear, do I look fat to you?

You're the size of a house, Maud!!


By mindless1 on 2/3/2009 1:21:55 AM , Rating: 2
Mouse-sized woolly m would be kinda cute, probably sell well in Japan.


Neanderthals
By scrapsma54 on 2/2/2009 8:14:30 AM , Rating: 3
Geiko shoulda saw it coming.




RE: Neanderthals
By rcxEric on 2/5/2009 12:14:33 AM , Rating: 1
how long iz i get ta wait b4 iz can bone me some neanderthal cuz i hear got like same brain az human but massive muscle. me kids be ger-ran-teed to be sportin sum massive dongs 4 sure


T-Rex
By supergarr on 2/5/2009 6:50:24 AM , Rating: 2
I want a pet T-rex




RE: T-Rex
By Davelo on 2/5/2009 6:28:50 PM , Rating: 2
I was wondering the same. Those pet T-Rexs make one hell of a watchdog.


"First Ever"
By twhittet on 2/2/2009 11:28:47 AM , Rating: 3
Ok, I usually let these slide, but for some reason the title bothers me this time. "First Ever Extinct Animal Cloned" makes it sound like they cloned the first thing to ever be extinct. We'd need a time machine just to figure out what animal that would have been!

How about "First Cloning of an Extinct Animal"?




The important question is
By Spookster on 2/2/2009 12:19:17 PM , Rating: 2
will this help me to save money on my car insurance by switching to Geico?




when.
By raphd on 2/2/2009 12:27:36 PM , Rating: 2
when can i eat it?




When will Dodo be on the menu?
By wordsworm on 2/5/2009 2:07:57 PM , Rating: 2
I always wanted to see what dodo tastes like. They look like they'd be at least as good as turkey... mmmmm.




Save the whales
By HostileEffect on 2/7/2009 2:01:08 PM , Rating: 2
If you got two whales, you can grow whatever variation died out, happy hunting.

On a side note... If they ever get genetics down, I wouldn't mind having a 6-7' tall proto-drake. (Warcraft reference)




I have a great idea!
By FaceMaster on 2/9/2009 3:41:14 PM , Rating: 2
Why don't we clone dinosaurs?

I can't belive nobody else has thought of that.




"Can anyone tell me what MobileMe is supposed to do?... So why the f*** doesn't it do that?" -- Steve Jobs














botimage
Copyright 2012 DailyTech LLC. - RSS Feed | Advertise | About Us | Ethics | FAQ | Terms, Conditions & Privacy Information | Kristopher Kubicki